Sequence ID | >W1710751740 |
Genome ID | LHRQ01000031 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus [LHRQ] |
Start position on genome | 2640 |
End posion on genome | 2715 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaaagacaat |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTAGAGCGACGGACTGTTAATCCGCAGGTCGCTGGTTCGAGC |
Downstream region at tRNA end position |
ctttcaatta |
Secondary structure (Cloverleaf model) | >W1710751740 Asn GTT t GCCA ctttcaatta T - A C - G C - G T - A C - G C - G T - A C G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |