Sequence ID | >W1710755688 |
Genome ID | LHZN01000110 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Gluconobacter albidus [LHZN] |
Start position on genome | 6472 |
End posion on genome | 6548 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcacgacgat |
tRNA gene sequence |
AGGGGTGTAGCTCAATTGGCTAGAGCGCCGGTCTCCAAAACCGGAGGTTGAGAGTTCGAG |
Downstream region at tRNA end position |
ctccttctcg |
Secondary structure (Cloverleaf model) | >W1710755688 Trp CCA t GCCA ctccttctcg A - T G - C G - C G - C G - C T + G G - C A G T C T C C C A T A A A | | | | G T C T C G G A G A G C G | | | | T T G G A G C C T A G AGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |