Sequence ID | >W1710758769 |
Genome ID | LIDW01000003 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium butyricum [LIDW] |
Start position on genome | 56619 |
End posion on genome | 56693 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
attgttgtat |
tRNA gene sequence |
GGCCCATTGGTCAAGAGGTCAAGACGTCACCCTCTCACGGTGAAATCATGGGTTCGATTC |
Downstream region at tRNA end position |
ttgcaataaa |
Secondary structure (Cloverleaf model) | >W1710758769 Glu CTC t ACCA ttgcaataaa G - C G + T C - G C - G C - G A - T T - A T T T T G C C C A A G A G | + | | | G G A C T G A T G G G C G | | | T T T A G A C C A G AATC T - A C - G A - T C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |