Sequence ID | >W1710759716 |
Genome ID | LIGR01000019 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas corrugata [LIGR] |
Start position on genome | 33887 |
End posion on genome | 33976 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gcgcgccact |
tRNA gene sequence |
GGAGAGATGCCGGAGTGGCCGAACGGGACGGATTCGAAATCCGTTGTACTGGCGACAGTA |
Downstream region at tRNA end position |
ttattgaata |
Secondary structure (Cloverleaf model) | >W1710759716 Ser CGA t GCCA ttattgaata G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G G C C T A G G G C G | | | T T C A C G G C G A G TGTACTGGCGACAGTACC A - T C - G G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |