Sequence ID | >W1710760546 |
Genome ID | LIHP01000017 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Marinobacter sp. HL-58 [LIHP] |
Start position on genome | 161320 |
End posion on genome | 161245 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gaagcgatgc |
tRNA gene sequence |
GTCCCCTTCGTCTAGTGGCCTAGGACTCCGCCCTTTCACGGCGGCAACAGGGGTTCGAAC |
Downstream region at tRNA end position |
acttctcatc |
Secondary structure (Cloverleaf model) | >W1710760546 Glu TTC c GCCA acttctcatc G - C T - A C - G C - G C - G C - G T - A C A T T C C C C A T G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A T CAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |