| Sequence ID | >W1710769175 |
| Genome ID | LISD01000006 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli [LISD] |
| Start position on genome | 45070 |
| End posion on genome | 44994 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
atttttatat |
| tRNA gene sequence |
GCGTTCATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCAGAGGTTCGAA |
| Downstream region at tRNA end position |
tactagcgga |
| Secondary structure (Cloverleaf model) | >W1710769175 Arg TCT
t ACCA tactagcgga
G + T
C - G
G - C
T + G
T - A
C - G
A - T T A
T T C T C C A
C G A A | | | | | G
T C T C G A G A G G C
G | | | | T T
G G A G C
A T A A AGGTC
A - T
C - G
G - C
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |