Sequence ID | >W1710773164 |
Genome ID | LIVU01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Micromonospora sp. TSRI0369 [LIVU] |
Start position on genome | 428025 |
End posion on genome | 427942 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggtgtgccct |
tRNA gene sequence |
GGCGGGTTGCCCGAGCGGCCAATGGGAGCGGACTGTAAATCCGTCGCGAAAGCTTCAGAG |
Downstream region at tRNA end position |
ggtgcagata |
Secondary structure (Cloverleaf model) | >W1710773164 Tyr GTA t ACCA ggtgcagata G - C G - C C - G G - C G - C G - C T - A T A T T C T C C A C G A G | | | | | G G G C C C A G A G G C G + | | | T T C T G G G C A A A CGCGAAAGCTTC G + T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |