| Sequence ID | >C08006433 |
| Genome ID | CP000943 |
| Phylum/Class | Alphaproteobacteria |
| Species | Methylobacterium sp. 4-46 [CP000943] |
| Start position on genome | 5909984 |
| End posion on genome | 5910059 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
gctctccttc |
| tRNA gene sequence |
GGGGCTGTAGCTCAGTTGGGAGAGCGCGTGCTTTGCAAGCATGAGGTCGTCGGTTCGATC |
| Downstream region at tRNA end position |
ctcccctcgc |
| Secondary structure (Cloverleaf model) | >C08006433 Ala TGC
c ACCA ctcccctcgc
G - C
G - C
G + T
G - C
C - G
T - A
G - C C T
T C T G C C A
T G A A | | | | G
T C T C G G T C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
G + T
T - A
G - C
C - G
T A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |