| Sequence ID | >C09110271 |
| Genome ID | FM252032 |
| Phylum/Class | Bacillota |
| Species | Streptococcus suis BM407 [FM252032] |
| Start position on genome | 1419106 |
| End posion on genome | 1419017 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
ctccatataT |
| tRNA gene sequence |
GGAAGATTACTCAAGAGGCTCAAGAGGCCGTGTTGGAAACGCGGTAGGCGTGTAACAGCG |
| Downstream region at tRNA end position |
gttattgaag |
| Secondary structure (Cloverleaf model) | >C09110271 Ser GGA
T GTat gttattgaag
G - C
G - C
A - T
A - T
G - C
A - T
T + G T A
T T A C C C A
A G A A + | | | | G
G A C T C G T G G G C
G | | | T T
C A G A G
T C A G TAGGCGTGTAACAGCGTGC
C - G
C - G
G - C
T + G
G - C
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |