Sequence ID | >C10101704 |
Genome ID | CP001982 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Priestia megaterium DSM 319 [CP001982] |
Start position on genome | 10891 |
End posion on genome | 10966 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttaaacgaat |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
attgttcttt |
Secondary structure (Cloverleaf model) | >C10101704 Ala TGC t ACCA attgttcttt G - C G - C G + T G - C C - G C - G T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |