| Sequence ID | >C11113812 |
| Genome ID | CP002382 |
| Phylum/Class | Bdellovibrionota |
| Species | Micavibrio aeruginosavorus ARL-13 [CP002382] |
| Start position on genome | 619564 |
| End posion on genome | 619638 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
tccccggcgc |
| tRNA gene sequence |
GCTGCCGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGAGAGTTCAATCC |
| Downstream region at tRNA end position |
ttttcccttt |
| Secondary structure (Cloverleaf model) | >C11113812 Thr GGT
c ACCA ttttcccttt
G - C
C - G
T - A
G - C
C - G
C - G
G + T C T
T C T C T C A
G A A | | | | | A
T C T C G G A G A G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
C - G
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |