| Sequence ID | >C11120406 |
| Genome ID | CP002773 |
| Phylum/Class | Gammaproteobacteria |
| Species | Serratia plymuthica AS9 [CP002773] |
| Start position on genome | 262465 |
| End posion on genome | 262540 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
tgcacttgat |
| tRNA gene sequence |
GCCGGCTTAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGATT |
| Downstream region at tRNA end position |
atcaagtcac |
| Secondary structure (Cloverleaf model) | >C11120406 Thr TGT
t ACCA atcaagtcac
G - C
C - G
C - G
G - C
G - C
C - G
T - A T T
T T G G C C A
T G A A | | | | G
T C T C G A C C A G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |