| Sequence ID | >C121001696 |
| Genome ID | CP001925 |
| Phylum/Class | Gammaproteobacteria |
| Species | Escherichia coli Xuzhou21 [CP001925] |
| Start position on genome | 1269956 |
| End posion on genome | 1270032 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
atatcacata |
| tRNA gene sequence |
CCGCCATTAGCTCATCGGGACAGAGCGCCAGCCTTCGAAGCTGGCTGCGCGGGGTTCGAG |
| Downstream region at tRNA end position |
ttatctgcat |
| Secondary structure (Cloverleaf model) | >C121001696 Arg TCG
a TCCA ttatctgcat
C - G
C - G
G - C
C - G
C - G
A - T
T - A T G
T G C T C C A
C T A A | | + | | G
G C T C G C G G G G C
G | | | | T T
G G A G C
A C A G CTGCG
C - G
C - G
A - T
G - C
C - G
C A
T A
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |