| Sequence ID | >C121002755 |
| Genome ID | CP002640 |
| Phylum/Class | Bacillota |
| Species | Streptococcus suis SS12 [CP002640] |
| Start position on genome | 1480985 |
| End posion on genome | 1480914 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
gagaagcaga |
| tRNA gene sequence |
CTTCCCTTAGTTAAATGGATATAACAAATTCCTCCTAAGAATTAGTTGCAGGTTCGATTC |
| Downstream region at tRNA end position |
aaatacaaca |
| Secondary structure (Cloverleaf model) | >C121002755 Arg CCT
a Atga aaatacaaca
C - G
T - A
T + G
C - G
C - G
C - G
T - A T T
T C G T C C A
T A A A | | | | | G
G A T T G G C A G G C
G | | | | T T
A T A A C
T A A AGTT
A - T
A - T
T - A
T - A
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |