| Sequence ID | >C131009290 |
| Genome ID | CP003889 |
| Phylum/Class | Bacillota |
| Species | Bacillus thuringiensis Bt407 [CP003889] |
| Start position on genome | 4959381 |
| End posion on genome | 4959454 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
atccatacaa |
| tRNA gene sequence |
GGACCTTTAGCTCAGTTGGTCAGAGCAGACGGCTCATAACCGTCCGGTCATAGGTTCAAA |
| Downstream region at tRNA end position |
ggtttttaaa |
| Secondary structure (Cloverleaf model) | >C131009290 Met CAT
a Attt ggtttttaaa
G - C
G - C
A - T
C - G
C - G
T - A
T - A T A
T T A T C C A
T G A A | | | | | A
T C T C G A T A G G C
G | | | | T T
G G A G C
T C A A CGGTC
G - C
A - T
C - G
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |