| Sequence ID | >C133000122 |
| Genome ID | CP003607 |
| Phylum/Class | Cyanobacteriota |
| Species | Oscillatoria acuminata PCC 6304 [CP003607] |
| Start position on genome | 443800 |
| End posion on genome | 443874 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
cgaaataccT |
| tRNA gene sequence |
GCCCCCATCGTCTAGAGGCCTAGGACACCTCCCTTTCACGGAGGCGACGGGGATTCGAAT |
| Downstream region at tRNA end position |
taccgcagtg |
| Secondary structure (Cloverleaf model) | >C133000122 Glu TTC
T ATta taccgcagtg
G + T
C - G
C - G
C - G
C - G
C - G
A - T T A
T C C C C T A
A G A C | | | | | G
G T C T G G G G G A C
G + | | | T T
C G G A C
C T A A CGAC
C - G
C - G
T - A
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |