| Sequence ID | >C141008340 |
| Genome ID | CP006773 |
| Phylum/Class | Alphaproteobacteria |
| Species | Leisingera methylohalidivorans DSM 14336 DSM 14336; MB2 [CP006773] |
| Start position on genome | 260735 |
| End posion on genome | 260811 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
ccgccgcagt |
| tRNA gene sequence |
GGACCGATAGCTCAGCTGGATAGAGTACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
| Downstream region at tRNA end position |
ctaatcttcg |
| Secondary structure (Cloverleaf model) | >C141008340 Arg ACG
t GCCA ctaatcttcg
G - C
G - C
A - T
C - G
C - G
G - C
A - T T A
T C C T C C A
C G A A | | + | | G
T C T C G G G G G G C
G | | | + T T
G G A G T
A T A A GGGTC
C - G
T - A
T - A
G - C
A - T
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |