| Sequence ID | >C151040575 |
| Genome ID | CP008934 |
| Phylum/Class | Bacillota |
| Species | Geobacillus stearothermophilus 10 [CP008934] |
| Start position on genome | 2324750 |
| End posion on genome | 2324825 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
cggcacttgT |
| tRNA gene sequence |
GCGCTCGTAGCTCAATTGGATAGAGCATCTGACTACGGATCAGAAGGTTAGGGGTTCGAA |
| Downstream region at tRNA end position |
tgtcgggaag |
| Secondary structure (Cloverleaf model) | >C151040575 Arg ACG
T GTtt tgtcgggaag
G - C
C - G
G - C
C - G
T - A
C - G
G - C T A
T T C T C C A
T A A A | | + | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
A T A A AGGTT
T - A
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |