| Sequence ID | >C151043049 |
| Genome ID | CP009086 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Enteritidis OLF-SE4-0317-8 [CP009086] |
| Start position on genome | 3259792 |
| End posion on genome | 3259867 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ccaccgccac |
| tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGCTTGGTCGCTGGTTCAAGT |
| Downstream region at tRNA end position |
aattttagct |
| Secondary structure (Cloverleaf model) | >C151043049 Met CAT
c ACCA aattttagct
G - C
G - C
C - G
C - G
C - G
C - G
T - A T G
T C G A C C A
T G A A | | | | | A
G C T C G G C T G G C
G | | | | T T
T G A G C
T A A TGGTC
G + T
G - C
C - G
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |