| Sequence ID | >C151059363 |
| Genome ID | CP009780 |
| Phylum/Class | Gammaproteobacteria |
| Species | Yersinia pseudotuberculosis PB1/+ [CP009780] |
| Start position on genome | 4264838 |
| End posion on genome | 4264912 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
gttctaagat |
| tRNA gene sequence |
GCGGGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGTGGGTTCGATTC |
| Downstream region at tRNA end position |
agatgtgctg |
| Secondary structure (Cloverleaf model) | >C151059363 Gly TCC
t TCCA agatgtgctg
G - C
C - G
G - C
G - C
G - C
C - G
A - T T T
T C A C C C A
T A A C | | | | | G
G T A T G G T G G G C
G | | | T T
C T T A C
T A C TGAT
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |