Sequence ID | >C151100967 |
Genome ID | HG738867 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli str. K-12 substr. MC4100 [HG738867] |
Start position on genome | 3567022 |
End posion on genome | 3566947 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccgctaccat |
tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGCTTGGTCGCTGGTTCAAGT |
Downstream region at tRNA end position |
gatatagcaa |
Secondary structure (Cloverleaf model) | >C151100967 Met CAT t ACCA gatatagcaa G - C G - C C - G C - G C - G C - G T - A T G T C G A C C A T G A A | | | | | A G C T C G G C T G G C G | | | | T T T G A G C T A A TGGTC G + T G - C C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |