| Sequence ID | >C161012686 |
| Genome ID | CP007374 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 [CP007374] |
| Start position on genome | 4232619 |
| End posion on genome | 4232694 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
tccaagatgt |
| tRNA gene sequence |
GCTGATATAGCTCAGTTGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCGGCAGTTCGAAT |
| Downstream region at tRNA end position |
cttcttttct |
| Secondary structure (Cloverleaf model) | >C161012686 Thr GGT
t ACCA cttcttttct
G - C
C - G
T - A
G - C
A - T
T - A
A - T T A
T C C G T C A
T G A A | | | | | G
T C T C G G G C A G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
A - T
C - G
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |