| Sequence ID | >C161014205 |
| Genome ID | CP007398 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 [CP007398] |
| Start position on genome | 1893049 |
| End posion on genome | 1892973 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
aatttttctt |
| tRNA gene sequence |
CCGCCATTAGCTCAACCGGATAGAGCATAGAGCTTCTACCTCTAAGGTTCGGGGTTCAAT |
| Downstream region at tRNA end position |
gttgatatca |
| Secondary structure (Cloverleaf model) | >C161014205 Arg TCT
t ACCA gttgatatca
C - G
C - G
G - C
C - G
C - G
A - T
T - A T T
T G C T C C A
C A A A | | + | | A
C C T C G C G G G G C
G | | | | T T
G G A G C
A T A A AGGTT
T - A
A - T
G - C
A - T
G - C
C C
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |