| Sequence ID | >C161016632 |
| Genome ID | CP007434 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 [CP007434] |
| Start position on genome | 1159531 |
| End posion on genome | 1159604 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
caaaaaattt |
| tRNA gene sequence |
GGCGCGTTAACAAAGCGGTTATGTAGCGGATTGCAAATCCGTCTAGTCCGGTTCGACTCC |
| Downstream region at tRNA end position |
atttttcccg |
| Secondary structure (Cloverleaf model) | >C161016632 Cys GCA
t TCCA atttttcccg
G - C
G - C
C - G
G - C
C - G
G - C
T - A T C
T A G G C C A
G A A | | | | | G
C A A C A T C C G G C
G | | | T T
G A T G T
T T A CTAG
G + T
C - G
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |