| Sequence ID | >C161027351 |
| Genome ID | CP010499 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni CJ677CC542 [CP010499] |
| Start position on genome | 1535418 |
| End posion on genome | 1535341 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
tttatttatt |
| tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGTTAGCGCACTTGGTTTGGGACCAAGGGGCCGAAGGTTCGA |
| Downstream region at tRNA end position |
ttttttataa |
| Secondary structure (Cloverleaf model) | >C161027351 Pro TGG
t ACCA ttttttataa
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T T T C C A
C T G A A + | | | | G
T C G C G G A A G G C
G | | | | T T
G G C G C
T T A A GGGCC
C - G
T - A
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |