| Sequence ID | >C161028443 |
| Genome ID | CP010776 |
| Phylum/Class | Bacteroidota |
| Species | Rufibacter sp. DG15C [CP010776] |
| Start position on genome | 965387 |
| End posion on genome | 965313 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
ccagttcact |
| tRNA gene sequence |
GGGCTTGTAGCTCAGGTGGTTAGAGCGCTACACTGATAATGTAGAGGTCCGTGGTTCGAG |
| Downstream region at tRNA end position |
taaagatctt |
| Secondary structure (Cloverleaf model) | >C161028443 Ile GAT
t ACtc taaagatctt
G - C
G - C
G - C
C - G
T + G
T - A
G - C T G
T G C A C C A
G G A A | | | | | G
T C T C G C G T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
T - A
A - T
C - G
A - T
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |