| Sequence ID | >C161043884 |
| Genome ID | CP012720 |
| Phylum/Class | Bacillota |
| Species | Bacillus anthracis PR01 [CP012720] |
| Start position on genome | 4652389 |
| End posion on genome | 4652316 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
ccaaaaacat |
| tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
| Downstream region at tRNA end position |
atttcaatat |
| Secondary structure (Cloverleaf model) | >C161043884 Ala TGC
t ACtt atttcaatat
G - C
G - C
G + T
G - C
C - G
C - G
T - A C T
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |