| Sequence ID | >C171066200 |
| Genome ID | CP017694 |
| Phylum/Class | Bacillota |
| Species | Geobacillus thermodenitrificans KCTC3902 [CP017694] |
| Start position on genome | 1261184 |
| End posion on genome | 1261109 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
ctcggcactT |
| tRNA gene sequence |
GCGCTCGTAGCTCAATTGGATAGAGCATCTGACTACGGATCAGAAGGTTAGGGGTTCGAA |
| Downstream region at tRNA end position |
acgggaagta |
| Secondary structure (Cloverleaf model) | >C171066200 Arg ACG
T GTtg acgggaagta
G - C
C - G
G - C
C - G
T - A
C - G
G - C T A
T T C T C C A
T A A A | | + | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
A T A A AGGTT
T - A
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |