| Sequence ID | >C171067689 |
| Genome ID | CP017775 |
| Phylum/Class | Bacillota |
| Species | Bacillus velezensis 9912D [CP017775] |
| Start position on genome | 167521 |
| End posion on genome | 167597 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
gatattaatt |
| tRNA gene sequence |
GCGCCCGTAGCTCAATTGGATAGAGCGTTTGACTACGGATCAAAAGGTTAGGGGTTCGAC |
| Downstream region at tRNA end position |
taatattttt |
| Secondary structure (Cloverleaf model) | >C171067689 Arg ACG
t GCCA taatattttt
G - C
C - G
G - C
C - G
C - G
C - G
G - C T C
T T C T C C A
T A A A | | + | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
A T A G AGGTT
T - A
T - A
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |