| Sequence ID | >C171072215 |
| Genome ID | CP018063 |
| Phylum/Class | Actinomycetota |
| Species | Rhodococcus sp. 2G [CP018063] |
| Start position on genome | 10161 |
| End posion on genome | 10234 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
atccgatcgg |
| tRNA gene sequence |
GCCCCCTTCGTCTAGCGGCCTAGGACGCCGCCCTTTCAAGGCGGTAGCGCGGGTTCGAAT |
| Downstream region at tRNA end position |
ttcgacctcg |
| Secondary structure (Cloverleaf model) | >C171072215 Glu TTC
g ACgc ttcgacctcg
G + T
C - G
C - G
C - G
C - G
C - G
T - A T A
T T G C C C A
C G A C + | | | | G
G T C T G G C G G G C
G + | | | T T
C G G A C
C T A G TAGC
C - G
C - G
G - C
C - G
C - G
C A
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |