| Sequence ID | >C171087648 |
| Genome ID | CP018995 |
| Phylum/Class | Gammaproteobacteria |
| Species | Escherichia coli Ecol_AZ147 [CP018995] |
| Start position on genome | 855119 |
| End posion on genome | 855045 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
atgccgcatt |
| tRNA gene sequence |
GTCCTCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAATTGCAGGTTCGATTC |
| Downstream region at tRNA end position |
tccttgtgtt |
| Secondary structure (Cloverleaf model) | >C171087648 Arg CCT
t ACCA tccttgtgtt
G - C
T - A
C - G
C - G
T + G
C - G
T - A T T
T C G T C C A
T A A A | | | | | G
G A T T G G C A G G C
G | | | | T T
A T A A C
T A G AATT
A - T
G - C
C - G
C - G
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |