| Sequence ID | >C171090580 |
| Genome ID | CP019184 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Minnesota str. ATCC ATCC 49284 [CP019184] |
| Start position on genome | 3212185 |
| End posion on genome | 3212111 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
ttttttattt |
| tRNA gene sequence |
GGGTCAGTCGTATAAAGGTCATTACGGAAGGCTGTTAACCTTCTTATCGTGGTTCGAGTC |
| Downstream region at tRNA end position |
aatatgctgg |
| Secondary structure (Cloverleaf model) | >C171090580 Asn GTT
t GCCA aatatgctgg
G - C
G - C
G - C
T T
C - G
A - T
G - C T G
T G C A C C A
A A A C | | | | | G
G T A T G C G T G G C
G | | | T T
T T T A C
C A G TTAT
G - C
A - T
A - T
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |