| Sequence ID | >C171105080 |
| Genome ID | CP020345 |
| Phylum/Class | Gammaproteobacteria |
| Species | Pasteurella multocida subsp. multocida CIRMBP-0884 [CP020345] |
| Start position on genome | 491457 |
| End posion on genome | 491382 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
gatatgaagc |
| tRNA gene sequence |
GGGTCGTTAGCTCAGTCGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGAAGGTTCGAAT |
| Downstream region at tRNA end position |
ctcaacgcaa |
| Secondary structure (Cloverleaf model) | >C171105080 Lys TTT
c ACCA ctcaacgcaa
G - C
G - C
G - C
T - A
C - G
G - C
T - A T A
T C T T C C A
T G A A | | | | | G
C C T C G G A A G G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
C - G
G - C
G - C
A - T
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |