| Sequence ID | >PL171001255 |
| Genome ID | CP016463 |
| Phylum/Class | Alphaproteobacteria |
| Species | Bosea sp. RAC05 plasmid:pBSY19_1 |
| Start position on genome | 438300 |
| End posion on genome | 438226 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
caatcctgtg |
| tRNA gene sequence |
GCCGGCGTAGCACAGCGGTAGTGCAGCGGTTTTGTAAACCGAAGGTCGGGAGTTCGATCC |
| Downstream region at tRNA end position |
tttccttagc |
| Secondary structure (Cloverleaf model) | >PL171001255 Thr TGT
g ACCA tttccttagc
G - C
C - G
C - G
G - C
G - C
C - G
G - C C T
T C T C T C A
G A A | + | | | G
C C A C G G G G A G C
G | | | | T T
G G T G C
T A A AGGTC
G A
C - G
G - C
G - C
T - A
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |